Disease information: Q fever is a bacterial disease that is caused by Coxiella brunetti. This disease is more abundant in animals, but Q fever has to potential to be used as biological warfare. It is an airborne that is contacted mainly by being in the environment of an affected animal. The symptoms vary to being flu like or it can be chronic and feel like hepatitis.
Essentiality of this protein: S-adenosylmethionine synthetase plays an essential role in metabolism in organisms. It catalyzes synthesis reactions. The formation is from methionine and ATP. The enzyme consists of four subunits and there are two active sites on the protein. Both S-adenosylmethionine and triphosphate are formed with the protein.
Link to TDR Targets page (if present): n/a
Link to Gene Database page NCBI: https://www.ncbi.nlm.nih.gov/protein/AML54077.1
Complex of protein: S-adenosylmethionine synthetase is an enzyme in Coxiella burnetii that has four subunits. It synethesises S-adenosylmethionine (AdoMet), pyrophosphate (PPi), and orthophosphate (Pi) from ATP and L-methionine.
Similarity to Humans: gene sequence isn’t found in BLASTP
Current inhibitors: There are 47 inhibitors
Expression information: Expression of the alpha subunit in E. coli, gel filtration
Purification Method: In humans, there are two methods. The first involved purification of the His-tagged protein under denaturing conditions of 8M urea and the second involved separation of SDS-PAGE.
NCBI#:NP_005902.1
Target: S-adenosylmethionine synthetase (EC 2.5.1.6)
Protein ID: 289455
Disease information:
Q fever is a bacterial disease that is caused by Coxiella brunetti. This disease is more abundant in animals, but Q fever has to potential to be used as biological warfare. It is an airborne that is contacted mainly by being in the environment of an affected animal. The symptoms vary to being flu like or it can be chronic and feel like hepatitis.
Essentiality of this protein:
S-adenosylmethionine synthetase plays an essential role in metabolism in organisms. It catalyzes synthesis reactions. The formation is from methionine and ATP. The enzyme consists of four subunits and there are two active sites on the protein. Both S-adenosylmethionine and triphosphate are formed with the protein.
Link to TDR Targets page (if present): n/a
Link to Gene Database page NCBI: https://www.ncbi.nlm.nih.gov/protein/AML54077.1
Complex of protein:
S-adenosylmethionine synthetase is an enzyme in Coxiella burnetii that has four subunits. It synethesises S-adenosylmethionine (AdoMet), pyrophosphate (PPi), and orthophosphate (Pi) from ATP and L-methionine.
Druggable Target (list number or cite evidence from a paper/database showing druggable in another organism):
https://www.ncbi.nlm.nih.gov/pubmed/19048023
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3183271/
EC#: 2.5.1.6
Link to BRENDA EC# page: http://www.brenda-enzymes.org/enzyme.php?ecno=2.5.1.6
Enzyme Assay information: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC285640/
Structure (PDB or Homology model): 4ODJ
Similarity to Humans: gene sequence isn’t found in BLASTP
Current inhibitors: There are 47 inhibitors
Expression information: Expression of the alpha subunit in E. coli, gel filtration
Purification Method: In humans, there are two methods. The first involved purification of the His-tagged protein under denaturing conditions of 8M urea and the second involved separation of SDS-PAGE.
Image of protein:
Amino acid sequence:
>fig|1294266.3.peg.2731|VBICoxBur279880_2731| S-adenosylmethionine synthetase (EC 2.5.1.6) [Coxiella burnetii Cb175_Guyana | 1294266.3]
atgacgcacacgaccttatttacctcagaatccgtttccgaaggtcacccggacaaggtg
gctgaccagatttcggacgccgttcttgacgccctgattggccaagaccccaactgtcga
gtggcttgcgaagccgtcgtaaaatccggaatggtttttgtggccggggaaatcaccacc
aacgcctgggcggacgtagaacaaattacccgcaacaccgttttacaaatcgggtataat
gacccccaccttggctttgacggggaaacgtgtgccgttgtcactgccattggaaagcaa
tcgcccgatatcgtcatgggtgtcgatggccgagaagaccaagaattaggggcgggcgac
caagggttaatgtttgggtacgcttctcgggaaaccgatgtttttatgccggctcccatc
acgtatgcccaccgacttgtacgccaacaagccctgttgcgcaaaaatggtcgacttcct
tggctgcgtcccgatgcgaaatcccaagtaaccttgcgttacgaaaacggaaaacccgtc
gccgccgactgtatcgtcctttccacccaacacagccccgaaattagccaagaaagctta
cgagaagccgtcatcgacgaaattatcaaacctatcatgccgccccattggctcgataaa
cacacgcgtttccttgtcaatccgacagggcgcttcgttatcggcggcccagtgggggat
tgcgggttaaccggtcgaaaaattatcgtcgatacctacggcgggatggcgcgccacggg
ggcgggtgtttctccggcaaagatccctccaaagtggatcgttcaggcgcttatgctgcc
cgttatgtagccaaaaatatcgtggctggcggcctcgccgatcgctgtgaaatacaagtt
tcctatgcaattggcgttgccgagcccacttcaataagtgtcgaaactttcggcacgggg
aaaattgacgaagtccgcattcagcaattaattaaagaacattttgatcttcgtcctggc
aaaattatcgaagaattgaacttattgagatccatttataaggccaccgccacctacgga
catttcggtcgagaagaacccgaatttacgtgggagcgaaccgataaagccgaaatactc
cgtgaagccgcgggtttagccgctgcaaacgtaaccaattaa
Length of your protein in Amino Acids: 1182
Molecular weight: 98009
Molar Extinction: 20,000
TMpred graph:
CDS Gene sequence:
at ggaatctttt ttgttcacat
241 ctgaatccgt caacgaggga catcccgaca agctttgtga tcagatctcc gacgctatcc
301 tcgatgcttg ccttgaacaa gaccctgaga gcaaagttgc ttgtgagact tgtaccaaga
361 ctaacatggt catggttttt ggagaaatca ccaccaaggc taacgttgat tacgagcaga
421 ttgttcgtaa aacatgccgt gagattggat tcgtctctgc tgacgttggt ctagatgctg
481 acaattgcaa ggttctggtt aacattgagc aacagagtcc tgacattgca caaggtgttc
541 atggtcatct caccaagaag ccagaggagg ttggagctgg tgaccaaggt cacatgtttg
601 ggtatgctac tgatgagact cctgagctca tgcctcttac tcacgttctc gctactaagc
661 ttggagctaa actcactgaa gttcgcaaga atggaacttg cccttggttg aggccagatg
721 gtaagactca agtcactatt gagtacatca acgaaagcgg agccatggtt cctgtacgtg
781 tccacactgt tctcatctca acacagcatg acgagactgt gactaacgat gagatcgcag
841 ctgatcttaa ggagcatgtg atcaagccag tgatcccaga gaaatacctt gatgagaaaa
901 ccatcttcca tctcaaccca tctggtcgtt ttgttatcgg aggtcctcat ggagatgcag
961 ggcttaccgg ccgtaagatc atcatcgata cttatggtgg ttggggtgca cacggaggtg
1021 gtgctttctc tggaaaggac ccaaccaagg ttgacaggag tggggcttac atcgttaggc
1081 aagcagctaa gagcattgta gccagtgggc tagcgaggcg ggtcattgtg caagtctcgt
1141 atgccattgg tgtccctgag ccattgtctg tgttcgtgga cagttatgga acaggaaaga
1201 taccagacaa ggagattctt gagattgtga aggagagttt tgatttcagg ccaggtatga
1261 tctccattaa cttggatctg aagagaggag gtaatggtag gttcttgaag actgctgcct
1321 atggtcactt tggaagggac gatgctgatt tcacctggga ggtagtcaag ccactcaagt
1381 ctaacaaggt ccaagcttga
GC% content for gene codon: 47%
Do Not Need this info for Spring (but still copy these lines to your Target page for now)
*GC% Content for gene:
output
*GC% Content for gene (codon optimized):
Primer design results for pNIC-Bsa4 cloning (list seqeunces of all of your ~40 nt long primers):
(link to DNA Works output text file - that should be saved in your Google Docs folder after you did the primer design protocol)
-- Ask a mentor, Dr. B, or a fellow researcher -how to link a GDocs file if you are not sure how to.
Primer design results for 'tail' primers (this is just 2 sequences):
**